bobisbosss1019 bobisbosss1019

03-04-2019
Geography

contestada

The Greek philosopher Democritus coined what word what does it mean

Respuesta :

lanaa22 lanaa22

03-04-2019

He coined the word atom. It means a tiny piece of matter that cannot be divided.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Dante has a vegetable garden. He places several earthworms in the garden’s soil. Which statement explains the most likely reason Dante puts worms in his garde

You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome

PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!

Differences between body composition- risk for heart disease or chronic disease.

Fractures of the blank of long bones are especially common in young animals

an equilateral triangle has perimeter 18 inches. what would be the perimeter of a square whose sides each measure the same length as the side of the triangle?

Can someone please help me with numbers 1, a, b, c, 2, a, b, c

2. For centuries, Africans enslaved other Africans. Name the two later slave trades that transported millions of Africans to distant lands to work.

Which country use tax brackets as part of their tax system? canada australia south africa all of the above?