veca33 veca33
  • 02-12-2019
  • Mathematics
contestada

What is the answer? Solve 4 ⋅ (−6)

Respuesta :

eai27 eai27
  • 02-12-2019
The answer to 4 • (-6) is -24
Answer Link

Otras preguntas

Someone please help me i’m confused
Are these 5 voice changes correct ?​
Define1. A paragraph2. Who is a feminist3. Mention 5 qualities of a good paragraph4. Define a Narrative Essay.35 pts​
How do the physical featuresof the UAE influence the life of the people?
what do you mean that mathematics as building blocks of technology revolution a society​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Solve the following inequality. m-2 <-2 OR 4m +3 > 15 3 m < [?] OR m > [ ]
Which of the following was a result of the Russo-Japanese War?
what conditions must be present for the effects of osmosis to occur?
s NOT contain carbon. Ex: minerals Smallest object that retains the properties of an element. Two or more atoms of an element chemically joined together Contain