avausher3 avausher3

03-02-2020
Mathematics

contestada

what is 50/2537 in simplified version?

Respuesta :

ruckusmakerb ruckusmakerb

03-02-2020

Answer:.01

Step-by-step explanation:

Answer Link

morgankwdm03 morgankwdm03

03-02-2020

Answer:

5/36 is the simplified fraction for 50/360. Simplify 50/360 to the simplest form

Step-by-step explanation:

5/36 is the simplified fraction for 50/360. Simplify 50/360 to the simplest form

Answer Link

Otras preguntas

Help pleaseeeeeeeeeeeeeee

Which evidence from the article is irrelevant to the author’s reasoning that foods containing phytochemicals fight cancer? a. “for example, apples contain flavo

5 examples of too broad

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

A box contains marbles marked numbers from 1 to 20. What is the probability of getting a prime number

How do the descriptions in this passage support Tan's purpose? Dinner threw me deeper into despair. My relatives licked the ends of their chopsticks and reached

What does b represent in the expressions.

5. According to the Bill of Rights what rights and freedoms are established for citizens of the United States

I have a math test in an hour and a half. It’s about algebraic word problems. Can someone help me. I’m really struggling in maths and might fail

How does ice affect water systems?