joseisantiago58 joseisantiago58

02-09-2020
Mathematics

contestada

When I simplify......

When I simplify class=

Respuesta :

ameerasabah ameerasabah

02-09-2020

Answer:

plz forgive me if my answer is wrong

Step-by-step explanation:

False

Answer Link

nermay7 nermay7

02-09-2020

Answer: False

Step-by-step explanation:

First evaluate the expression.

(3m^2 n)^4

3^4 * m^8 n^4

[tex]81m^{8} n^{4}[/tex]

Answer Link

Otras preguntas

1. use the graph of y = sin θ to find the value of sin θ for each value of θ. 270°please help

How did censorship and propaganda help fortify post ww1 dictatorships?

Many worship services include a speech given by a church leader. this speech is called a

What would be the △Y and the △X for the line that passes through the points (–5, 4) and (2, –2)

what are good websites to study for biology?

please help me if you can, thank you!

need help anybody know how to do this

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The striton family had a meal catered for a wedding rehearsal dinner. The cost of the dinner was $476. There was a 5% sales tax and they left a 15% tip. What wa

Name a few important body functions that your nervous system controls on its own without you having to think about it much?