jocsyn23 jocsyn23

01-03-2021
Chemistry

contestada

If we add 150mL of ammonia to 150mL of water, what is the concentration by volume?

Respuesta :

mb312928 mb312928

01-03-2021

Answer:

buffer solution

Explanation:

Answer Link

Otras preguntas

what are the zeros of the function? f(x)=+-6x

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Now that you have worked through a lot of material that includes these basic patterns, and you have compared grammatically correct and incorrect sentences, writ

What is the distance between 407 squared and negative 68 squared

William Blake believed that it was necessary to A. use experience as the pathway to God. B. eradicate evil from the human condition. C. fear darkness or lose

31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr

Why did the United States go to war with Britain in 1812

A deck of cards is shuffled and three cards are delt. find the chance the second card is spade and the third card is heart

can someone help me please

A school bus has 22 rows of seats, and 4 students can be seated in each row. students have filled 19 rows of seats, abd 1/2 of the remaining seats. how many sea