molleyy molleyy
  • 01-05-2021
  • Social Studies
contestada

Why is achieving
gender equality important?

Respuesta :

ktecroft
ktecroft ktecroft
  • 01-05-2021

Gender equality establishes equal opportunities for education and employment. It is essential for countries to establish gender equality, and grant human rights, so, it can develop (through its economy, policies, etc).

Answer Link

Otras preguntas

round 7,782 to the nearest hundred
Fossils are most commonly found in which type of rock?
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
A generator stores electric current. Explain why you agree or disagree with this statement
Why is California warm and moderately humid but Nevada is hot and dry? A. The two states are at different latitudes. B. As air moves west over California's mo
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
the perimeter of a square 116ft ?
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?