kushabroy12345678 kushabroy12345678
  • 02-03-2017
  • Mathematics
contestada

whatis the difference between draw and construct

Respuesta :

LazyLegion LazyLegion
  • 02-03-2017
To draw it means to write ; as construct means to build with physical objects!
hope this helps!
:D
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
How much money, in dollars, does one mole of nickels represent?
does radiation need a phase of matter to travel with?
Why were the committees of correspondence powerful?
Explain who or what "Año Viejo" is and its significance.
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
The Panama Canal connects what two bodies of water?