carolinavgf carolinavgf
  • 04-08-2017
  • Chemistry
contestada

Convert 30 g/L to the unit g/mL.
A) 30,000 g/mL
B) 300 g m/L
C) 0.03 g/mL
D) 0.0003 g/mL

Respuesta :

percypercy168otvzio
percypercy168otvzio percypercy168otvzio
  • 04-08-2017
It's A, just do conversion factors to find the end, mL
Answer Link

Otras preguntas

A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
what are 2 points on the graph for 6x-5y=25
How do you write fifty-seven thousand,eighteen. In standard form
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5